SGN Marker solcap_snp_sl_16137

SGN-M19483

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71100)
Chromosome
5
Position
49.76 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67450)
Chromosome
5
Position
57.90 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63880)
Chromosome
5
Position
77.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55814)
Chromosome
5
Position
59.79 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CGTGAGGAAGTTATCAAGATGGTTAAGACATGATCAGGTGCGTGTTCTTA
  
3' flanking region
GACAGACCCTTTTGTGGGAAATCAAGAAAAAGGGTATGTTGTTAAGGAGA
SNP nucleotide
TG
SNPdb format
CGTGAGGAAGTTATCAAGATGGTTAAGACATGATCAGGTGCGTGTTCTTA[T/G]
GACAGACCCTTTTGTGGGAAATCAAGAAAAAGGGTATGTTGTTAAGGAGA
  
Genomic location of solcap_snp_sl_16137  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19483 marker 19483
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)