SGN Marker solcap_snp_sl_16145

SGN-M19489

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71104)
Chromosome
5
Position
52.52 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67454)
Chromosome
5
Position
61.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63884)
Chromosome
5
Position
71.60 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55820)
Chromosome
5
Position
60.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGGCAACACTTCACCTGTCCCGGTATCTGATCTTGTCAGCATTTTGGAGA
  
3' flanking region
GTTGTTAAAGGTAAAGGCTAAGAGATTGATTATGAAGTTACCAAGGAATG
SNP nucleotide
AT
SNPdb format
GGGCAACACTTCACCTGTCCCGGTATCTGATCTTGTCAGCATTTTGGAGA[A/T]
GTTGTTAAAGGTAAAGGCTAAGAGATTGATTATGAAGTTACCAAGGAATG
  
Genomic location of solcap_snp_sl_16145  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19489 marker 19489
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)