SGN Marker T1358

SGN-M1950
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 9.01
Tomato EST read: TPTAP09TH
Arabidopsis best BAC match: AL034567.1
Arabidopsis position: 4.1650000
Arabidopsis identities: 0.855
Best GenBank protein hit: AAF89961.1
Evalue: 5e-120
Identities: 0.909
Description: cellulose synthase-1 [Zea mays]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49426)
Chromosome
8
Position
43.87 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47360)
Chromosome
8
Position
26.41 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39590)
Chromosome
8
Position
20.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1358 was used as an overgo probe on plate 13 [well B3]

Plausible BAC Matches:   P292D13,   P334K16,   P050P21

 Overgo Sequences

A sequence
ATGCATGCACGAGGATGGTATTCC
B sequence
GAGGCATGCAATAGAGGGAATACC
AB sequence
ATGCATGCACGAGGATGGTATTCCCTCTAT
Marker sequence
GCTTGGAGAAGCTGTTTGGTCAATCACCAGTGTTTATTGCTGCCACATTT
ATGGAACAAGGAGGCATTCCTGCATCCACTAATCCTGCATCTCTTTTGAA
AGAAGCAATTCATGTTATTAGCTGTGGCTACGAGGACAAGACTGAATGGG
GAAAAGAGATTGGGTGGATATATGGATCTGTCACTGAAGATATTTTGACT
GGGTTTAAGATGCATGCACGAGGATGGTATTCCCTCTATTGCATGCCTCC
TCGACCAGCATTTAAAGGGTCTGCTCCTATCAATCTTTCTGATCGTTTAA
ACCAGGTGCTCCGGTGGGCTTTGGGTTCTGTTGAAATCCTGTTGAGTAAG
CATTGCCCAATATGGTATGGCTACAGTGGCAGATTGATGCTTCTGGAGAG
ATTAGCATATATTAATACAATCGTCTATCCTCTCACATCTTTACCCTTGC
TTGCTTACTGTACGCTTCCTGCCATCTGTCTTCTGACCGGCAAATTTATC
ATTCCTGAGATAAGCAACTATGCTGGCATGTGGTTCATTCTACTCTTTCT
TTCCATTTTCGCAACTGGTATATTGGAGCTTANGTGGAGTGGTGTGAGTA
TTGAAGACTGGTGGAGAAATGAACAGTTCTGGGTCATTGGTGGTACATCG
GCTCACTTGTTTGCAGTTTT
Genomic location of T1358  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1950 marker 1950
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)