SGN Marker solcap_snp_sl_16331

SGN-M19504

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71107)
Chromosome
1
Position
58.46 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67457)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55835)
Chromosome
1
Position
72.80 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGAAGTAAGATTGGCAAGAGAGGCAGAAGCAGCCATGGATTTACATGTC
  
3' flanking region
ACAAAGCAGCAGAGAAGATTGCAAATGAAGAACAAAAGTATGTTCATGAT
SNP nucleotide
AC
SNPdb format
GTGAAGTAAGATTGGCAAGAGAGGCAGAAGCAGCCATGGATTTACATGTC[A/C]
ACAAAGCAGCAGAGAAGATTGCAAATGAAGAACAAAAGTATGTTCATGAT
  
Genomic location of solcap_snp_sl_16331  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19504 marker 19504
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)