SGN Marker T1359

SGN-M1951
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.13
Tomato EST read: TPTAP10TH
Arabidopsis best BAC match: AC011622.4
Arabidopsis position: 1.1215000
Arabidopsis identities: 0.714
Best GenBank protein hit: AAF09157.1
Evalue: 6.3e-90
Identities: 0.782
Description: putative aminopeptidase; 4537-10989 [Arabidopsis thaliana]
Comment: protease from procaryotic origin
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39591)
Chromosome
8
Position
73.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35602
Forward primer (5'-3')
TTTGAGAGGCATGATGGTCA
Digested band sizes (using AciI)
Solanum lycopersicum LA925: 335+400
Solanum pennellii LA716: 335+515
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TCCCACCGGTTAAACTCATC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pennellii LA716: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 105
Forward primer (5'-3')
Unknown
Digested band sizes (using AciI)
Solanum pennellii LA716: 335+515
Solanum lycopersicum LA925: 335+400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 850
Solanum lycopersicum LA925: 850
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1359 was used as an overgo probe on plate 12 [well G5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGCTGGATTCAAGTGGTAAGGAC
B sequence
CCGAAGATAGAGGCATGTCCTTAC
AB sequence
CTGCTGGATTCAAGTGGTAAGGACATGCCT
Marker sequence
GTATTTCTGTTATCAGGGAGCTGAAGTGGTCAGGATGTACAAAACCTTGT
TAGGTAGCCAAGGATTTAGAAAAGGAACAGATTTATATTTTGAGAGGCAT
GATGGTCAAGCAGTAACATGTGAAGACTTTTTTGCTGCCATGCGAGATGC
CAACAATGCAGATTTTGCTAATTTCTTGTTATGGTACTCGCAAGCTGGGA
CACCTGTAGTGAAGGTTACCACAAATTATAATGCTGAAGGGCGCACTTTC
TCCCTCAAGTTTAGTCAAGAGGTGCCTCCAACCCCCGGCCAGTCTGCAAA
AGAACCTGTGTTTATTCCTGTTGCTGTAGGTCTGCTGGATTCAAGTGGTA
AGGACATGCCTCTATCTTCGGTTCATCATGATGGGAAATTGGAGAGTTTT
GCAAGCAGTGGTCAAAACGTATACACCACAGTTCTCCGCGTAACGAAGAA
GGAGGAGGAATTTGTGTTCAATGACGTATCTGAGAGGCCAACACCATCTA
TATTGCGAGGTTTCAGTGCTCCCATCAGGCTTGAGTCTGATCTCACTGAT
AGTGATCTACTTTTCCTTCTTGCTCATGATTCTGATGAGTTTAACCGGTG
GGAGGCGGGACAAGTGTTGGCAAAGAAGTTGATGCTCAGTCTGGTAGCTG
ATTTCCAAC
Genomic location of T1359  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1951 marker 1951
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)