SGN Marker T1361

SGN-M1953
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAP22TH
Arabidopsis best BAC match: AC004667.2
Arabidopsis position: 2.1940000
Arabidopsis identities: 0.717
Best GenBank protein hit: AAC61823.1
Evalue: 8.7e-58
Identities: 0.575
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39593)
Chromosome
2
Position
34.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1361 was used as an overgo probe on plate 11 [well D1]

Plausible BAC Matches:   P054F20,   P052L14

 Overgo Sequences

A sequence
ATCAGTAGAGGCGGATTCAGATGG
B sequence
TGGAGGCACTTGCTTTCCATCTGA
AB sequence
ATCAGTAGAGGCGGATTCAGATGGAAAGCA
Marker sequence
GCCTGGTCTTATTTTCATGTTGGTCTCTAAATGTCCGCTGAATCATATCC
TTTTTGAACCAAGAATCAGTAGAGGCGGATTCAGATGGAAAGCAAGTGCC
TCCAATGAAGTTCCTGTTGAGAAGTGGAAGCAAGATAGCATTTTCATTGA
TAGACGCGGCAGATTTAGACACTTTGATCACAAAAAAGTTTCACGGAAAA
GATGTGGTTCTTTAAGGGGCAGAGGATGGAAATATGGATCTGGTTTTGTT
GATGGTATATTCCCAGTTCTAAGCCCAATTGCTCAGCAAATTCTAACTTT
TATAAAGACGGAAAAAGATCCAGAGAGGATTTGGTCTTCCTTGGATACTC
TACGTCCCACCAATCACACCTGGGATGATCTAATCAATGTAGCAGTTCAA
CTTCGACTCAACAAACAATGGGATCTGATCATACTGATGTGTGAATGGAT
ACTATGCAGGAGTTCCTTTCAGGCAGATGTGATTTGCTACAATTTGCTCA
TAGAAGCTTATGGGCAGAGTTCACTTGTTAAGAAGGCAGAATCTACTTAC
CTGGCACTTGTTGATGCTCGATGTGTCCCGACTGAAGAT
Genomic location of T1361  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1953 marker 1953
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)