SGN Marker solcap_snp_sl_16579

SGN-M19530

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71119)
Chromosome
9
Position
7.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67466)
Chromosome
9
Position
40.82 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55861)
Chromosome
9
Position
4.65 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGGGAGGGGGGAAGGGGGGTCAACGCCCAACTCGTGTCATCACAAGGCGT
  
3' flanking region
TTTCACTTCTATAAAGAATGTAAGAAGTGGCAAGAAAATTCATCAACTGA
SNP nucleotide
AG
SNPdb format
GGGGAGGGGGGAAGGGGGGTCAACGCCCAACTCGTGTCATCACAAGGCGT[A/G]
TTTCACTTCTATAAAGAATGTAAGAAGTGGCAAGAAAATTCATCAACTGA
  
Genomic location of solcap_snp_sl_16579  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19530 marker 19530
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)