Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

Due to a hardware issue, SGN was briefly unavailable earlier today. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_16593

SGN-M19534

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55865)
Chromosome
9
Position
4.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGAAGATGACATTGAGTTTGTTGGATCAGCCACATCCTCCAACGCCACC
  
3' flanking region
CCACTAATGGCTCTGGGATCTTTGACATTATTGGACACTTCTCTCAACCT
SNP nucleotide
AG
SNPdb format
ACGAAGATGACATTGAGTTTGTTGGATCAGCCACATCCTCCAACGCCACC[A/G]
CCACTAATGGCTCTGGGATCTTTGACATTATTGGACACTTCTCTCAACCT
  
Genomic location of solcap_snp_sl_16593  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19534 marker 19534
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)