SGN Marker solcap_snp_sl_16638

SGN-M19535

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55866)
Chromosome
9
Position
2.28 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCATGGGGATATGATCATTCAACTCAGAAAACTCCATGGTCATTGCAGC
  
3' flanking region
TCAATGCTGCTCTCTCTAAATCACTTTTATCTATAAAGATGAAGGTAAAT
SNP nucleotide
AC
SNPdb format
GTCATGGGGATATGATCATTCAACTCAGAAAACTCCATGGTCATTGCAGC[A/C]
TCAATGCTGCTCTCTCTAAATCACTTTTATCTATAAAGATGAAGGTAAAT
  
Genomic location of solcap_snp_sl_16638  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19535 marker 19535
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)