SGN Marker solcap_snp_sl_17068

SGN-M19567

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67481)
Chromosome
1
Position
46.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55898)
Chromosome
1
Position
74.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTCAGAAAACGAGGAGAAGCCTGGTAATTTATCATCATGATGATGCATT
  
3' flanking region
TGAAAGTCAGTTTATATTATTAATGATGAAATACTAAAAAGACTCAGATA
SNP nucleotide
AT
SNPdb format
CCTCAGAAAACGAGGAGAAGCCTGGTAATTTATCATCATGATGATGCATT[A/T]
TGAAAGTCAGTTTATATTATTAATGATGAAATACTAAAAAGACTCAGATA
  
Genomic location of solcap_snp_sl_17068  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19567 marker 19567
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)