SGN Marker solcap_snp_sl_17496

SGN-M19592

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67489)
Chromosome
9
Position
3.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55923)
Chromosome
9
Position
0.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCCTCTCACAACCCCAACTCGCCGGTCTTTTTCTTCCCTTTCTGCTAATC
  
3' flanking region
CAATCGATTATCTTCTCCATTCGCTTTACAATCGAACAAGCTCAAATTCG
SNP nucleotide
CG
SNPdb format
GCCTCTCACAACCCCAACTCGCCGGTCTTTTTCTTCCCTTTCTGCTAATC[C/G]
CAATCGATTATCTTCTCCATTCGCTTTACAATCGAACAAGCTCAAATTCG
  
Genomic location of solcap_snp_sl_17496  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19592 marker 19592
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)