SGN Marker solcap_snp_sl_17501

SGN-M19594

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67490)
Chromosome
9
Position
3.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55925)
Chromosome
9
Position
0.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTTTCTGTAAGCTTATTTTGATCTTCCAGAATTCATAAATTTGCTCCAA
  
3' flanking region
TCTTTGCCAACTTCGTTGGAGAATGAAAGAAATGCAGCCGAATTGATCTT
SNP nucleotide
AG
SNPdb format
CCTTTCTGTAAGCTTATTTTGATCTTCCAGAATTCATAAATTTGCTCCAA[A/G]
TCTTTGCCAACTTCGTTGGAGAATGAAAGAAATGCAGCCGAATTGATCTT
  
Genomic location of solcap_snp_sl_17501  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19594 marker 19594
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)