SGN Marker solcap_snp_sl_17524

SGN-M19607

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67496)
Chromosome
9
Position
1.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55938)
Chromosome
9
Position
0.27 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTACAAGGAAGTGCCCGCTCTATAGGAGCGGCCTTTCGTGGAGCATTACC
  
3' flanking region
GATGCACCTTCGCCAGCAGCATTCCTGAATGAAGTGAAAATATCTTCCCC
SNP nucleotide
AT
SNPdb format
CTACAAGGAAGTGCCCGCTCTATAGGAGCGGCCTTTCGTGGAGCATTACC[A/T]
GATGCACCTTCGCCAGCAGCATTCCTGAATGAAGTGAAAATATCTTCCCC
  
Genomic location of solcap_snp_sl_17524  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19607 marker 19607
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)