SGN Marker solcap_snp_sl_17531

SGN-M19611

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67498)
Chromosome
9
Position
0.64 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 55942)
Chromosome
9
Position
0.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAACAAGCAGATGTGAACTCTCTACTTTTATTATTGGGATTATTATGTCA
  
3' flanking region
GTGTTGCCTTTGATGTTTCGTTATGCTGGAGTTGGAGAATCAGCAGCAAT
SNP nucleotide
TC
SNPdb format
AAACAAGCAGATGTGAACTCTCTACTTTTATTATTGGGATTATTATGTCA[T/C]
GTGTTGCCTTTGATGTTTCGTTATGCTGGAGTTGGAGAATCAGCAGCAAT
  
Genomic location of solcap_snp_sl_17531  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19611 marker 19611
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)