SGN Marker solcap_snp_sl_18441

SGN-M19718

Synonyms  
CL017181-0294
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67532)
Chromosome
2
Position
65.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56049)
Chromosome
2
Position
39.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATAGTAGGGGTGACCACCATCGCTCCAGGGACCGGGACAGGGACAGAGA
  
3' flanking region
AGAGACAGAGATAGGGAAAGAGAAAGGGAGTCGAGGGACCGGGAGGTGGA
SNP nucleotide
TC
SNPdb format
GATAGTAGGGGTGACCACCATCGCTCCAGGGACCGGGACAGGGACAGAGA[T/C]
AGAGACAGAGATAGGGAAAGAGAAAGGGAGTCGAGGGACCGGGAGGTGGA
  
Genomic location of solcap_snp_sl_18441  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19718 marker 19718
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)