SGN Marker solcap_snp_sl_18451

SGN-M19728

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56059)
Chromosome
2
Position
39.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTTCACTCCATACTTACAGAACCAGAGGCCCAGAGCCATGCCTTAAGAGC
  
3' flanking region
AGGAATTGTGGCTTGAGCTTCAGTTCATGCATAAGCTGAGTCACTTCATT
SNP nucleotide
AG
SNPdb format
GTTCACTCCATACTTACAGAACCAGAGGCCCAGAGCCATGCCTTAAGAGC[A/G]
AGGAATTGTGGCTTGAGCTTCAGTTCATGCATAAGCTGAGTCACTTCATT
  
Genomic location of solcap_snp_sl_18451  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19728 marker 19728
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)