SGN Marker solcap_snp_sl_18452

SGN-M19729

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67536)
Chromosome
2
Position
65.75 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56060)
Chromosome
2
Position
39.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTACAAACTTGCAATGCTTGTATCTCGAATTTGCCAAAATCCGCAAGTGT
  
3' flanking region
TCATAGCTGCGGGGAAACTGTTTTAGATAGGGCCACCACCTAGAACTCTT
SNP nucleotide
TG
SNPdb format
CTACAAACTTGCAATGCTTGTATCTCGAATTTGCCAAAATCCGCAAGTGT[T/G]
TCATAGCTGCGGGGAAACTGTTTTAGATAGGGCCACCACCTAGAACTCTT
  
Genomic location of solcap_snp_sl_18452  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19729 marker 19729
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)