SGN Marker T1391

SGN-M1973
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAR37TH
Arabidopsis best BAC match: AP000372.1
Arabidopsis position: 5.1750000
Arabidopsis identities: 0.695
Best GenBank protein hit: BAA98190.1
Evalue: 2.6e-54
Identities: 0.651
Description: regulator of chromosome condensation (cell cycle regulatory protein) like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49428)
Chromosome
10
Position
1.95 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47362)
Chromosome
10
Position
19.37 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42384)
Chromosome
4
Position
36.30 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39598)
Chromosome
10
Position
17.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 11492)
Chromosome
4
Position
15.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T1391 was used as an overgo probe on plate 15 [well G3]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
ATTGGTATGGGATCCGACGCTTAC
B sequence
GTATAGGAGTAGGCTCGTAAGCGT
AB sequence
ATTGGTATGGGATCCGACGCTTACGAGCCT
Marker sequence
GGATGCTCCGGTTACTGAAGCACGGGAGAACTCCGGCGGAACGCCTTTCC
CGCCGATGGATGAGCAGCGGCAGTCATAGCAAAACAACGGTGATGAGCTT
CGGTGACGGAAGCCACGGAGCTTTGGGCCTTCCGTCGTCCATCATTGGTA
TGGGATCCGACGCTTACGAGCCTACTCCTATACCCGGTCTCCCGCCTGAC
GTCGTTACCGTCGCCGCCGGTCACTTCCACTCCCTCGCCGTTACTTCTGA
GGGACATGTTTGGGCTTGGGGACGTAATAATGAAGGCCAGCTTGGCCGTG
ATCCCCTTTCTCCCAGAGAAACGTGGAATGAACCAAAAAGAGTAGAAGGA
CTACATAAAGTACGAGTTCAAACCGCATTTGCATCAGGTGTCATTTCTGC
CGCCATAGGAGATGATGGATCTCTATGGGTTTGGGGAAGTTCTAAGCGTG
GGCAGCTTGGTCTTGGCAAGGGAATCACCAACACTGCATTACCTTCGAAA
ATTGAAACACTTTCTGGAGAA
Genomic location of T1391  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1973 marker 1973
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)