SGN Marker solcap_snp_sl_18453

SGN-M19730

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63937)
Chromosome
2
Position
95.48 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56061)
Chromosome
2
Position
39.91 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGGGAAACTGTTTTAGATAGGGCCACCACCTAGAACTCTTACCCTTGTTC
  
3' flanking region
CTTCATTTAACAATCCAACAGCCAATATCTGCAGTAGAAATAAGATCAAA
SNP nucleotide
AG
SNPdb format
GGGGAAACTGTTTTAGATAGGGCCACCACCTAGAACTCTTACCCTTGTTC[A/G]
CTTCATTTAACAATCCAACAGCCAATATCTGCAGTAGAAATAAGATCAAA
  
Genomic location of solcap_snp_sl_18453  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19730 marker 19730
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)