SGN Marker solcap_snp_sl_18641

SGN-M19748

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56079)
Chromosome
1
Position
64.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GGAACATAAATTGCTTGAAGCTTTTCCGATCAACTTTTATCGCCGGAGTT
  
3' flanking region
CACTGGAGCTCTGACGGAGACGTGTGCTTGCCAGGATTTCGTAATCTGAA
SNP nucleotide
TC
SNPdb format
GGAACATAAATTGCTTGAAGCTTTTCCGATCAACTTTTATCGCCGGAGTT[T/C]
CACTGGAGCTCTGACGGAGACGTGTGCTTGCCAGGATTTCGTAATCTGAA
  
Genomic location of solcap_snp_sl_18641  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19748 marker 19748
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)