SGN Marker T1394

SGN-M1976
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAR47TH
Arabidopsis best BAC match: AC008113.4
Arabidopsis position: 1.1330000
Arabidopsis identities: 0.759
Best GenBank protein hit: AAF26947.1
Evalue: 1.6e-18
Identities: 0.759
Description: unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39599)
Chromosome
10
Position
58.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1394 was used as an overgo probe on plate 16 [well B5]

Plausible BAC Matches:   P139D12

 Overgo Sequences

A sequence
GAAAACAGCTGTCCCATTTCCTGG
B sequence
GCCATGATAGCTTCTGCCAGGAAA
AB sequence
GAAAACAGCTGTCCCATTTCCTGGCAGAAG
Marker sequence
GCATTTATTCACTGGACTCGAGCTGAAATATATTGAGTGCAATCGTCCTT
CCAATTCTAGAAAATTTGACAGTCAGGCAAATTGTTACCAGTACAGCTTT
GTAATTCAATCTATTGCTTCCAGAAGGAAATAGAATCCATTGCCATTTGA
AAGCCTTGCTTGATGCTGGGGAACTAGAAGAGGATACAGGATTGAAACTA
CACGAACTGTTAGCCATTAGCTATGAGCAATGCATGTGTTTCGAGATTCA
GCAGCATTCAGAAAACAGCTGTCCCATTTCCTGGCAGAAGCTATCATGGC
ATTGTTTTCTTGAGGAACTTCTCAACTTTGACAGCACCATGTATCTCTCC
AAGCATTCCTCTCAGTTATCCTCCACCATCAGTAGTTTCAGTGGCCTGCC
TAACCCAATCAGATGCTCCACAACGTTCTGAGGAGTGGTTTGCCCTTCGC
AAAGACAAATTAACTACAAGCACCTTCAGCACTGCTTTAGGATTCTGGAA
AGGGAATCGACGATATGAGCTCTGGCATGAGAAGGTATTTGCTCCAGAAG
TCCAATTACTACCATCT
Genomic location of T1394  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1976 marker 1976
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)