SGN Marker solcap_snp_sl_18959

SGN-M19768

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71188)
Chromosome
3
Position
50.35 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56099)
Chromosome
3
Position
46.89 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCATGCTGGCAGAGGAAGTGAGAGAAATTATGTCTCAACTTGGTTTCAGA
  
3' flanking region
CACTTACTGAAATGGTTGGCCGTTCAGACATGCTTGAAATGGACAATGAT
SNP nucleotide
AG
SNPdb format
TCATGCTGGCAGAGGAAGTGAGAGAAATTATGTCTCAACTTGGTTTCAGA[A/G]
CACTTACTGAAATGGTTGGCCGTTCAGACATGCTTGAAATGGACAATGAT
  
Genomic location of solcap_snp_sl_18959  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19768 marker 19768
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)