SGN Marker T1395

SGN-M1977
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TPTAR48TH
Arabidopsis best BAC match: AL022140.1
Arabidopsis position: 4.1140000
Arabidopsis identities: 0.815
Best GenBank protein hit: AAD33072.1
Evalue: 6.9e-89
Identities: 0.929
Description: secretory peroxidase [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49429)
Chromosome
2
Position
39.32 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47363)
Chromosome
2
Position
81.85 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39600)
Chromosome
2
Position
72.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1395 was used as an overgo probe on plate 11 [well F1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGCTTCGTTGAGTCATGTGATGC
B sequence
GTCCAGCAACAAGGAAGCATCACA
AB sequence
CTGCTTCGTTGAGTCATGTGATGCTTCCTT
Marker sequence
TGGCTACCAAACATCTTTTTTTCTTTGCTATTCTCTTTTTTTCAGCTGCC
TCTGTTTTTGCAGAGGAAAATCCTAGCCTTAAAATGGACTATTACAAGGA
CACTTGCCCTCAAGCTGAAGAAATCATCAAAGAACAAGTCAAACTTCTCT
ACAAACGCCACAAGAATACTGCATTTTCTTGGCTAAGAAACATATTCCAT
GACTGCTTCGTTGAGTCATGTGATGCTTCCTTGTTGCTGGACTCAACAAG
GAGGATGCTGTCTGAGAAAGAGACAGACAGGAGTTTTGGTATGAGAAATT
TCAGATACATTGAGACTATTAAAGAAGCTGTAGAAAGGGAATGCCCTGGT
GTTGTTTCTTGTGCTGATATTCTTGTTTTGTCTGGTAGAGATGGTATTGT
TGCACTAGGAGGGCCACACATTCCTCTCAAAACTGGAAGAAGAGATGGAA
GAAAAAGCAGAGCAGACATTCTTGAACAGCACCTCCCAGATCACAATGAA
AGCATGAGTGTTGTTCTTGAAAGATTTGCTAACATTGGAATCAACACCGC
TGGAGTTGTTGCCTTGCTAGGG
Genomic location of T1395  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1977 marker 1977
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)