Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

SGN Marker solcap_snp_sl_18978

SGN-M19771

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71190)
Chromosome
3
Position
52.83 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56102)
Chromosome
3
Position
48.96 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAATCATGTGTATAGTAGTAGAACATTATAATAAAGACCAAGATTTTCTC
  
3' flanking region
TACTAATTTAAACTCTCTTATAAAATAGGCTGTGTTCATTCAGGGGCGAT
SNP nucleotide
AG
SNPdb format
AAATCATGTGTATAGTAGTAGAACATTATAATAAAGACCAAGATTTTCTC[A/G]
TACTAATTTAAACTCTCTTATAAAATAGGCTGTGTTCATTCAGGGGCGAT
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_18978  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19771 marker 19771
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)