SGN Marker solcap_snp_sl_19102

SGN-M19788

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71201)
Chromosome
5
Position
12.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67561)
Chromosome
5
Position
15.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63953)
Chromosome
5
Position
17.05 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56119)
Chromosome
5
Position
1.86 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCTGGAAGACATGTTGGAGGATCGTACGTGTATGGTTCAAAGGGATTGTC
  
3' flanking region
AACAGAAAATAACTGGACGACGGGCTGCATGAGTTATCACATTGATAGGA
SNP nucleotide
TG
SNPdb format
TCTGGAAGACATGTTGGAGGATCGTACGTGTATGGTTCAAAGGGATTGTC[T/G]
AACAGAAAATAACTGGACGACGGGCTGCATGAGTTATCACATTGATAGGA
  
Genomic location of solcap_snp_sl_19102  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19788 marker 19788
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)