SGN Marker T1399

SGN-M1979
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.01
Tomato EST read: TPTAR66TH
Arabidopsis best BAC match: AC006929.3
Arabidopsis position: 2.1580000
Arabidopsis identities: 0.826
Best GenBank protein hit: BAB16318.1
Evalue: 1.7e-73
Identities: 0.778
Description: chaperonin-60 alpha subunit [Avicennia marina]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49430)
Chromosome
6
Position
42.93 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47364)
Chromosome
6
Position
79.30 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39601)
Chromosome
6
Position
76.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1399 was used as an overgo probe on plate 4 [well B4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGTGAACGATGGAGTCACGATTGC
B sequence
TAGCTCTATGGCTCGAGCAATCGT
AB sequence
AGTGAACGATGGAGTCACGATTGCTCGAGC
Marker sequence
AGGAATGTGGTTTTAGACGAATATGATACCCCAAAAGTAGTGAACGATGG
AGTCACGATTGCTCGAGCCATAGAGCTAGCTGATGCCATGGAAAATGCAG
GCGCAACCCTTATCAGAGAGGTTGCAAGCCTAACCAATGATGCTGCTGGT
GACGGGACAACAACTGCATCTGTTCTTGCCAGGGAAATCATTAAGCATGG
TCTTTTAAGTGTTACATCTGGTGCAAATCCAGTCTCTCTGAAGAGAGGCA
TTGACAAAACTGTTAATGCTTTGGTTGCAATGCTAGAACGGAGGGCTAGG
CCTGTTAAAGGTCGTGATGACATCAAAGCTATTGCTTCTATCTCTGCTGG
AAATGATGATGA
Genomic location of T1399  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1979 marker 1979
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)