SGN Marker TG482

SGN-M198

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1000
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AAGCAATATCAGAATCAATGGACAATGGGACAGTTGTGCCAATTTGAACTTCTAAAAGGTAAGGTTAATAATAATTCACAATTAACATCA
TGTAACGCACTGAACTACTTGACACAACACACACACTATCCACCCCTCAAAGCACTAGAAGGAAAGAGAACAAAAGCTACTGCATCGCAG
TTTTCATGAAAAATTCTGGACAAATTACAACGAACAAGAGAGTAAATTGCTGGTGTTGCAAAGAAGACTAAGGTTATCCGGAAACTAGAG
ATCCTTATGTAAGCTAAGAAAGGAGTTGTAAGGGGTGGGAAAAAGGCAAAACACCATTTTGCAGACCCCATCAATTGTTTCTCGAAGTTC
ATACTTAAGTCAAAGTCATTCTGACTTCCATATACTATAGCAACTAGCAAGAAGTAGTTGGTTCTAGAACTTTTAGAATTATAAATGC
Reverse sequence
TTGGATATGCTACGCCACCATGTGTTTCTAGAGAACTCGCCGAAAGTTGCTCTGAATATGTCACAACAGTGGTAATGCAGGTCAGTAACT
AATCCATACAGACCCTTTTTTTTCTTTTTTTTTCCTTCTCAAGATATTTTAATAATGAATCAACAGCAGAGTACTTTCCTCAGATTTTTG
TTTTTATCAACTTTTGCTATGTTTTCCAACTAGGTTCTTATTGAAGTGCATATTGATTGACTGCTGGAATTCCACTGTGTTTTGTGGTGC
AGGATGATATAATACCTAGGTTAAGTATCGCCTCTCTCACAAGGCTTAGGAATGAAATTCTTCAAACTAACTGGTAAGCAAATGTAATGT
TAAGAGTGGTCCTTGGTTCTTTCTCAATTATTGTGCTGGTGTTGCATTAAACCTGATATCTGTGGCCCTAGATTGCATATAAATGTACTT
GCATATCATGCAATTA
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50400)
Chromosome
6
Position
45.51 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48333)
Chromosome
6
Position
107.97 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42474)
Chromosome
6
Position
129.70 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40061)
Chromosome
6
Position
98.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8550)
Chromosome
6
Position
109.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8552)
Chromosome
6
Position
135.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8551)
Chromosome
6
Position
95.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG482 was used as an overgo probe on plate 2 [well C8]

Plausible BAC Matches:   P098L02

 Overgo Sequences

A sequence
ACGCACTGAACTACTTGACACAAC
B sequence
GGTGGATAGTGTGTGTGTTGTGTC
AB sequence
ACGCACTGAACTACTTGACACAACACACAC
Marker sequence
AAGCAATATCAGAATCAATGGACAATGGGACAGTTGTGCCAATTTGAACT
TCTAAAAGGTAAGGTTAATAATAATTCACAATTAACATCATGTAACGCAC
TGAACTACTTGACACAACACACACACTATCCACCCCTCAAAGCACTAGAA
GGAAAGAGAACAAAAGCTACTGCATCGCAGTTTTCATGAAAAATTCTGGA
CAAATTACAACGAACAAGAGAGTAAATTGCTGGTGTTGCAAAGAAGACTA
AGGTTATCCGGAAACTAGAGATCCTTATGTAAGCTAAGAAAGGAGTTGTA
AGGGGTGGGAAAAAGGCAAAACACCATTTTGCAGACCCCATCAATTGTTT
CTCGAAGTTCATACTTAAGTCAAAGTCATTCTGACTTCCATATACTATAG
CAACTAGCAAGAAGTAGTTGGTTCTAGAACTTTTAGAATTATAAATGC
Genomic location of TG482  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D198 marker 198
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)