SGN Marker T1400

SGN-M1980
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.05.01
Tomato EST read: TPTAR67TH
Arabidopsis best BAC match: AC013288.5
Arabidopsis position: 1.1275000
Arabidopsis identities: 0.750
Best GenBank protein hit: BAA13688.1
Evalue: 4.1e-55
Identities: 0.612
Description: AR401 (pheromone receptor) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49431)
Chromosome
2
Position
47.15 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47365)
Chromosome
2
Position
132.16 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39602)
Chromosome
2
Position
119.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1400 was used as an overgo probe on plate 11 [well A6]

Plausible BAC Matches:   P194N24

 Overgo Sequences

A sequence
ACTACCGAGCCGATTACAGTTCTG
B sequence
TCCTGCTCATCCTTGTCAGAACTG
AB sequence
ACTACCGAGCCGATTACAGTTCTGACAAGG
Marker sequence
CATCTCGATTCATCACACATGGCCGGGATGAGACTGTTACCGGAGGACCC
CGACGTCGCGCAGGTCCGACCAACGGCATCAGCCGATCTGATTTCCGACG
ACGACCGCTCTGTGGCGGCCGATTCGTGGTCCATAAAGAGCGAATACGGA
AGTACTCTCGATGATGAGCAGCGCCACGCTGATGCTACTGAAGCTCTTAA
CTACCGAGCCGATTACAGTTCTGACAAGGATGAGCAGGAAGGTGAAGGAG
TTTCTTCAATGCTTGGTTTCCAAAGCTATTGGGATGCTGCTTACGCCGAT
GAATTGACAAACTTTCGTGAGCATGGTCACACTGGTGAAGTTTGGTTTGG
TGGTGACGTCATGGAAAATGTTGTCTCATGGACCAAAGGTTTGTGCATGG
ACATTTGCAAGAGTAATTTGCCAAATCACGTAGCTGATGCCGATTCTGAG
CCTGTTGGGCAGCGTGAGATTGACATTTCAGGTTGGAGTGTGCTTGATAT
TGGGACTGGCAATGGTCTGCTTTT
Genomic location of T1400  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1980 marker 1980
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)