SGN Marker solcap_snp_sl_19481

SGN-M19800

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71210)
Chromosome
1
Position
115.95 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67569)
Chromosome
1
Position
104.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63960)
Chromosome
1
Position
186.96 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56131)
Chromosome
1
Position
86.71 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGAGCTGCAAGAATCGAATGGCTCGGACAAGGCCCGAGGCAAAAACAGC
  
3' flanking region
CCGAGGCGAAGAACTTGCTCGCGCTCATAGAGACCGCAGAGCATTTGAGT
SNP nucleotide
AG
SNPdb format
TGGAGCTGCAAGAATCGAATGGCTCGGACAAGGCCCGAGGCAAAAACAGC[A/G]
CCGAGGCGAAGAACTTGCTCGCGCTCATAGAGACCGCAGAGCATTTGAGT
  
Genomic location of solcap_snp_sl_19481  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19800 marker 19800
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)