Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker solcap_snp_sl_195

SGN-M19801

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71211)
Chromosome
5
Position
75.91 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67570)
Chromosome
5
Position
78.79 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63961)
Chromosome
5
Position
129.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56132)
Chromosome
5
Position
62.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGAGATTGAATTACTGGAAGATAAAGTGCTGACGTTGGGTGGGTTTTCT
  
3' flanking region
CTGTTGAAGCTGAGCTTAAAAAGCTTTCACACGAAAGAGAGAGGCTACTC
SNP nucleotide
AT
SNPdb format
ATGAGATTGAATTACTGGAAGATAAAGTGCTGACGTTGGGTGGGTTTTCT[A/T]
CTGTTGAAGCTGAGCTTAAAAAGCTTTCACACGAAAGAGAGAGGCTACTC
  
Genomic location of solcap_snp_sl_195  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19801 marker 19801
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)