SGN Marker T1405

SGN-M1982
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.05.01
Tomato EST read: TPTAR86TH
Arabidopsis best BAC match: AC009243.3
Arabidopsis position: 1.1490000
Arabidopsis identities: 0.677
Best GenBank protein hit: AAF17692.1
Evalue: 1.5e-67
Identities: 0.677
Description: "similar to beta-1,4-xylosidase dbj|BAA24107[Arabidopsis thaliana]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39605)
Chromosome
4
Position
77.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35603
Forward primer (5'-3')
CACCAACAACTAGCCCTTGA
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 160+375
Solanum pennellii LA716: 535
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
AAGCAATTCCTCCAGCTTCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 535
Solanum lycopersicum LA925: 535
Approximate temperature
55°C
  
PCR data   Exp. ID 64
Forward primer (5'-3')
Unknown
Digested band sizes (using ApoI)
Solanum lycopersicum LA925: 160+375
Solanum pennellii LA716: 535
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 535
Solanum lycopersicum LA925: 535
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1405 was used as an overgo probe on plate 1 [well F11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AATACCGGCAAGTTGCTGCCTCTT
B sequence
TGGTTTTCGCCTTGGAAAGAGGCA
AB sequence
AATACCGGCAAGTTGCTGCCTCTTTCCAAG
Marker sequence
GACAACACCAACAACTAGCCCTTGAAGCTGCAAGAAATGGCATTGTCTTG
CTCAAGAATACCGGCAAGTTGCTGCCTCTTTCCAAGGCGAAAACCAACTC
CCTTGCTGTCATTGGTCATAATGCCAACAATGCTTATATTCTCCGTGGGA
ACTATGACGGTCCTCCTTGCAAATACATCGAAATACTCAAGGCGTTGGTT
GGTTATGCAAAGTCAGTTCAGTACCAACAGGGTTGCAATGCGGCTAACTG
CACGTCTGCTAACATTGATCAAGCTGTCAACATTGCAAGAAATGCAGATT
ATGTTGTTTTAGTCATGGGGTTGGATCAAACTCAAGAGAGGGAACAATTT
GATCGCGATGACTTAGTGCTCCCGGGGCAGCAAGAAAATCTTATCAATAG
TGTTGCTAAAGATGCAAAGAAGCCTGTTATATTGGTGATTCTCTCAGGAG
GTCCAGTTGATATTTCTTTCGCGAAATATAACCCTAAAATAGGAAGCATT
TTGTGGGCTGGCTATCCTGGTGAAGCTGGAGGAATTGCTTTAGCTGAAAT
CATATTTGGTGAACATAATCCT
Genomic location of T1405  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1982 marker 1982
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)