SGN Marker T1407

SGN-M1984
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAS08TH
Arabidopsis best BAC match: AC002535.2
Arabidopsis position: 2.2540000
Arabidopsis identities: 0.756
Best GenBank protein hit: AAC62851.1
Evalue: 8.2e-31
Identities: 0.636
Description: photolyase/blue-light receptor (PHR2) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49432)
Chromosome
9
Position
62.46 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47366)
Chromosome
9
Position
61.38 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39606)
Chromosome
9
Position
61.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1407 was used as an overgo probe on plate 15 [well H3]

Plausible BAC Matches:   P044B02,   P278J12,   P208B10

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CTCTTAACCCTCTTCGTCCTTCTG
B sequence
GCAGCATTAGAAGGCTCAGAAGGA
AB sequence
CTCTTAACCCTCTTCGTCCTTCTGAGCCTT
Marker sequence
GGTCGCTTATCTTCATCTTCTTCCTCTGATTCTGTACATTTCTCACCGGA
AAACTCATCAGAAATGGATCCAAAGAATCAATTTTCCGATAACTCAGAAG
CCCAAACACCTCAAGAAGAACAACAGCAGACACCCATCTTACCGATAGCT
TCAATTTCACTTGCTTTATCCACAATCCTTCCAACCCATTTCCTTAATCC
TCCTAAAATCTCAACCCTTTTCAACAAACCAAACAAAGTCAAAATCCCGA
CTCAAGTTTCATCTCTTACAAATCTCTCACTTTCAGCTTCTTCTCTTCCA
CCTACGAATTCCAAATTCAAGTCCACTATTTCTGCTAACCCTCTTCAAAA
TACTCTAACTCTTAACCCTCTTCGTCCTTCTGAGCCTTCTAATGCTGCTG
GGCTTCGACGAGCGTCGATTGTTTGGTTCCGTAACGATCTTCGTGTTCAT
GATAATGAGTGTCTTAACGCGGCTCATAATGAGTCCATGTCTGTATTGGC
TGTTTACTGGTTTGACCCGAGAGATTATGGGAAATCCTCATCTGGGTTTG
ATAAAACTGGGCC
Genomic location of T1407  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1984 marker 1984
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)