SGN Marker solcap_snp_sl_19822

SGN-M19845

Synonyms  
SGN-U568176_snp105
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63976)
Chromosome
2
Position
2.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56176)
Chromosome
2
Position
1.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTCTGTACACTCTGTAAACTCCACGGAAGAGAGACAGGAGAGAGTACAAG
  
3' flanking region
TTTGCTGCCATGGAACTGTTTGGTGCCAATCAACAAAACACCCAAATGTG
SNP nucleotide
TC
SNPdb format
TTCTGTACACTCTGTAAACTCCACGGAAGAGAGACAGGAGAGAGTACAAG[T/C]
TTTGCTGCCATGGAACTGTTTGGTGCCAATCAACAAAACACCCAAATGTG
  
Genomic location of solcap_snp_sl_19822  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D19845 marker 19845
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)