SGN Marker T1413

SGN-M1987
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAS27TH
Arabidopsis best BAC match: AC002521.2
Arabidopsis position: 2.0110000
Arabidopsis identities: 0.711
Best GenBank protein hit: AAC05351.1
Evalue: 6.4e-49
Identities: 0.513
Description: putative receptor-like protein kinase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39609)
Chromosome
1
Position
28.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1413 was used as an overgo probe on plate 3 [well H6]

Plausible BAC Matches:   P271G02,   P190A14,   P299F16,   P242C01,   P032H01,   P093C04,   P282P11,   P250H05,   P002N12,   P179P22,   P017B19,   P027O17,   P093K10,   P200K19,   P179M04

 Overgo Sequences

A sequence
TACTGACTGTGCTGGTACATGACG
B sequence
CTGCCTGTTGATTCACCGTCATGT
AB sequence
TACTGACTGTGCTGGTACATGACGGTGAAT
Marker sequence
GGCGATACGAGAGGAGAGGGATATACAAATTAGTTTGTTGAATTATAGGA
AGGATGGGACACCATTTTGGATGTTGTTTCATATGTGTCCTGTTTTCGAT
GAGAAGGACGGGAGAGTGATTCATTTCTTGGGAGTTCAAGTTCCAATTTT
TAGGAGGCCTAAGCCATCTGGAGTTGGACTAAATTTATGCCAAGATGTAG
CTGGCTGTCGAGAGTCGGTGCTTAGGTGTTATAGAAGGGAAGTTCACTCC
ATGAGCGTGGAACGGGCACTGTCTCTTGTATCAGGTTCAGGCTTGGATTT
CACAGGAATAGATGTAGAGGGGCCGTGTGATGCAAATGATCTAGAGAAGA
GAAAAGCCACTGCTGTTATAAACAACATACTGACTGTGCTGGTACATGAC
GGTGAATCAACAGGCAGACTAGTCAATGGAAAGAGACATTCTCAACCTGN
GACGGGTCTGCTCGGAGCATCCTTAAATATATCTCTTGGTAGAATCAAAC
AAAGCTTTGTATTAACTGATGCTAACTTACCTGACATGCCAATTGTCTTT
GCAAGCGATAACTTTCTGAAATTAACAGGCTTTTCAAAAAATGAAGTGTT
GGGCTATAACTGTAGATCTTTTAGTGGGAC
Genomic location of T1413  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1987 marker 1987
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)