Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T1414

SGN-M1988
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAS31TH
Arabidopsis best BAC match: AC011623.3
Arabidopsis position: 3.0114000
Arabidopsis identities: 0.558
Best GenBank protein hit: AAF08570.1
Evalue: 1.4e-29
Identities: 0.454
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39610)
Chromosome
7
Position
22.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1414 was used as an overgo probe on plate 7 [well H6]

Plausible BAC Matches:   P328B07,   P034K06,   P086F12,   P279M04,   P294I14,   P026C01,   P051K05,   P042K02,   P247D07,   P325D07,   P018M19,   P286G23,   P263C19,   P019A19

 Overgo Sequences

A sequence
TGTCTCCTCTCTCTACTCATGGTC
B sequence
AAAGGATGCCGGCAATGACCATGA
AB sequence
TGTCTCCTCTCTCTACTCATGGTCATTGCC
Marker sequence
GATTTGGTTAATCATGGAAGGTCTTTACTCCAACATCCATTACTATCTTG
TTGAACATCCAACAATCAGCCAATTTGAATGGAAACAAGGTCACACTTTT
GGTTCTTCCATTTCTTTTCTTACTATTTCCGTCTCTGTTTACTTATGTCT
GACTCTCTTGTCGATTCGTTTATCTACATTTATCCCTACCCTCACTACCA
CCACCATTCGCAACTTTACCGCGATACACAGCCTCATTCTTTGTCTCCTC
TCTCTACTCATGGTCATTGCCGGCATCCTTTCTGTCTTACACCAAATGCC
ACCTCATGATTGGAAGTGGATCGTATGTTTTCCCGGTGCCAATCATACTC
TTCCACGTGGACCTGTGTTCTTTTGGATTTATATTTGTTATCTTTCAAAA
ATTCTTGAATTTATTGATACACTCTTAATCGTCCTAAGTAGTTCTAGATC
AAGAAGGTTATCGTTCCTTCATGTCTATCACCACACACTTGTGACGGTTC
TTGGTTATATTGGGCTTCAATATGCACAGTCCATGTTGGGACTTGCTCTT
ATAGTCAACGCTTCGATTCATGTTATAATGTATGCGTATTATTTCTTATC
C
Genomic location of T1414  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1988 marker 1988
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)