SGN Marker T1416

SGN-M1990
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAS47TH
Arabidopsis best BAC match: AC006072.3
Arabidopsis position: 2.2560000
Arabidopsis identities: 1.000
Best GenBank protein hit: AAD13708.1
Evalue: 8.9e-32
Identities: 0.955
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39611)
Chromosome
9
Position
57.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1416 was used as an overgo probe on plate 7 [well C3]

Plausible BAC Matches:   P211L03,   P222C18,   P296O18,   P099F14,   P018J01,   P077E14,   P016F10

 Overgo Sequences

A sequence
TAGCAGTTGGTCGCTTCATCAGAC
B sequence
AAGTCAGAGCACTGCAGTCTGATG
AB sequence
TAGCAGTTGGTCGCTTCATCAGACTGCAGT
Marker sequence
GCTTGCTAGGTGATACTCTCAGCAAATTCAGTATATGGGGTCTCTACATC
ACATTTGTTTTAGCAGTTGGTCGCTTCATCAGACTGCAGTGCTCTGACTT
ACGGATGAGAATCCCATATGAAAATCTTCCTTCATGTGATAGATTGATTG
CCATCTGTGAGGATATATATGCTGCAAGAGCAGAGGGTGAGCTCGTGGTG
GAGGAAATCCTATACTGGACATTAGTGAAGATATACAGGTCCCCGCACAT
GTTGCTCGAGTATACTAAGTCTGATTAGCCTAGTAAGAAAAGTTTACTCT
CAACTGCAACTGATGTTTGTCCTAACGCATATGTAGAAGAGTGACTAACC
AATACCCCATAGAATTCATCTTTATCCTTGCAGTGAACATGCCAAAACTT
CCAAACGATCTTTTTTGTTTTAGCTTGAAGTGGAGCAGATGACAGAAACA
TTTGTAAATATAGGCAGAGTGCAAAATATAGCAACAGTTCTGTTTAAAAC
ACACCTTATAGTTNTCTGGCAATGAGAAGGTTCTCAATTC
Genomic location of T1416  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1990 marker 1990
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)