SGN Marker T1421

SGN-M1993
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 6.04
Tomato EST read: TPTAS63TH
Arabidopsis best BAC match: AC002330.1
Arabidopsis position: 4.0160000
Arabidopsis identities: 0.715
Best GenBank protein hit: AAC19285.1
Evalue: 2.3e-58
Identities: 0.724
Description: putative chloroplast outer envelope 86-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49434)
Chromosome
9
Position
62.23 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47368)
Chromosome
9
Position
60.54 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39612)
Chromosome
9
Position
60.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1421 was used as an overgo probe on plate 16 [well E6]

Plausible BAC Matches:   P169J20,   P045K04,   P013K01,   P127P06,   P188H19,   P001O06,   P099P03,   P243G10,   P190D11,   P183A19,   P168E03,   P214D10

 Overgo Sequences

A sequence
CTCAGCTTGCTAAGCTCAGCAAAG
B sequence
TACGCCTTCCTCTGTTCTTTGCTG
AB sequence
CTCAGCTTGCTAAGCTCAGCAAAGAACAGA
Marker sequence
GGGCAAGCAGTATGCGATTTACTAATGATGAGTCCAAGTCTGATGAATCC
CGTCTCTCTGGTAGAAAATCATCCATCGTGCAGGAGGAATAGGGATGGAC
ATAAGATACTACCTAATGGCCAGAGCTGGAGGCCTCAATTACTACTATTA
AGCTACTCAATGAAGATCTTATCTGAAGCAAGTGCACTTTCAAAGCCTGA
AGATCCATTTGATCACCGTAAGCTCTTTGGTTTCCGCACACGCTCACCAC
CTCTTCCCTACATGCTTTCTTCAATGTTGCAGTCACGTGCGCATCCAAAG
CTTTCTGCTGAGCAGGGTGGTGACAACGGTGATTCAGACATTGACTTAGA
TGATTTGTCAGACTCTGACCAAGAAGAAGAAGATGAGTATGACCAGCTTC
CTCCCTTCAAGCCTCTTCGGAAGGCTCAGCTTGCTAAGCTCAGCAAAGAA
CAGAGGAAGGCGTACTTTGAGGAGTATGACTATAGGGTCAAGCTCCTTCA
GAAGAAACAGTTGAGAGAAGAGTTAAAAAGAATGAAAGAGATGAAAAGTA
AGGGAAAAGAGGCTGCAATTGACAATGGTTATGCA
Genomic location of T1421  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1993 marker 1993
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)