SGN Marker TG76

SGN-M2

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2100
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
AATGTAGTTGATAAGGAAAATTTTCATTCTGCTGCAGGATATTGATTGGAGACAGCGGCTTGCTCTTCAACAAATCAAACCTTTGTTGAC
AAAAGAGGCAAGTTTTCAATTTTTTAAATTTTGTTATTAAGTATAGCATTCTCCTTTCGGTCTGCAATGAGGATAAATTTCTTACTCTTA
ATTAAACATGCATACTTTTCAGGTGATTGACATCATCAAAGCCAGTACTGATGATTTAGGACCTCTCAGTCTTGATTCTCTTAGAAAGAA
CAATTTGTCTGCCTCATGGAAATTTGTTGGGCAAGAAATTGTAGCCAAGAAAAGTGCAGCTGATGCACAGGTCTGGATTTTTTGTATTTT
TGTTACTAAAACTGTCTCCTGAAAAATCACGTAACTAGCAAGATACTAATTTTGTTATCTCTTTTGATGTATCGCAGGTAAATAAGCCGA
GTCAGGTAGCTGCAGCAGATTCCAAACCAGAAATCACCAGAGGCAAACGTGATGGTCCTGTTGATGGTAAATAGCTTGTTACAGATTTTG
ATGATAAATTTAGTGCCTCATGCACATATTAATAATCAAAGACTTATTTTTCAGGG
Reverse sequence
ATCTACATTCTCAACATGGATTGTAGCTTTTCCATGAGGGTTCAACAAAAACCACATGTTCATAGCTCCAAAGTTCAATTTATCACTGAC
TAGATGAAAGACATGTTTCTCTGGTTCCTGCAAAATATCAACTCACATCTTCAAATACCCGCTACAAACATAGTGCTAATTTCATTAAAG
CCAAAAGTATAGGTGATGAACTACAGAAACATGCAAGGCAGCGAAATATGTTCAAGGGTACCCCAACTATAGCATGTTTTTGACAATTGG
TGATAGTTATCATGAATTGGAAGGAAGTGGTAATGCACCAACAAGTAACAAGCCAGAAAGCAACTTACAGTTTCTCTCAGACACAACACA
ATCTTTAAAGCTTAAAGGCAAATGTGGATGATGGTCTCCGAAATATCAAACAGAACTCACCTTAGCATTCACGATAGTTGAGTTGACAAC
GACTGAAGCAGCCAAAACATTATCAGAAAATAGGGCATAATGGAAGAGATCAGGATTTTCCAGATTCTCGCTTCTTGGGAAC
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1567075.7e-2964 (10.7% of RFLP seq)+
SGN-U1567072.6e-4083 (13.9% of RFLP seq)+
SGN-U1567071.6e-75142 (23.8% of RFLP seq)+
SGN-U1616091.3e-29113 (21.2% of RFLP seq)-
SGN-U1616091.4e-35115 (21.6% of RFLP seq)-
SGN-U1457272.9e-58113 (21.2% of RFLP seq)-
SGN-U1457271.9e-59119 (22.4% of RFLP seq)-
Mapped locations  
Map: Pepper-AC99   
Map version
34 (location: 7706)
Chromosome
10
Position
11.51 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7705)
Chromosome
1
Position
62.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992
Overgo hybridization and physical mapping 
TG76 was used as an overgo probe on plate 5 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CAGAAATCACCAGAGGCAAACGTG
B sequence
CCATCAACAGGACCATCACGTTTG
AB sequence
CAGAAATCACCAGAGGCAAACGTGATGGTC
Marker sequence
AATGTAGTTGATAAGGAAAATTTTCATTCTGCTGCAGGATATTGATTGGA
GACAGCGGCTTGCTCTTCAACAAATCAAACCTTTGTTGACAAAAGAGGCA
AGTTTTCAATTTTTTAAATTTTGTTATTAAGTATAGCATTCTCCTTTCGG
TCTGCAATGAGGATAAATTTCTTACTCTTAATTAAACATGCATACTTTTC
AGGTGATTGACATCATCAAAGCCAGTACTGATGATTTAGGACCTCTCAGT
CTTGATTCTCTTAGAAAGAACAATTTGTCTGCCTCATGGAAATTTGTTGG
GCAAGAAATTGTAGCCAAGAAAAGTGCAGCTGATGCACAGGTCTGGATTT
TTTGTATTTTTGTTACTAAAACTGTCTCCTGAAAAATCACGTAACTAGCA
AGATACTAATTTTGTTATCTCTTTTGATGTATCGCAGGTAAATAAGCCGA
GTCAGGTAGCTGCAGCAGATTCCAAACCAGAAATCACCAGAGGCAAACGT
GATGGTCCTGTTGATGGTAAATAGCTTGTTACAGATTTTGATGATAAATT
TAGTGCCTCATGCACATATTAATAATCAAAGACTTATTTTTCAGGG
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG76  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2 marker 2
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)