SGN Marker TG35

SGN-M200

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2300
Vector
pUC
Cutting Site
PST1
Drug Resistance
AMP
Image
TG35 image not available
Forward sequence
AAATGTGCAGTTTAGTGAATCAATCAACTAAACAATGCACAGTTACTAATTGAAGAAATACGCAAGCACGTATACATTTAACTGAACTCT
ACTTGTCAGGAGAATGTAAAAAGAGAAATAACAAAGGTATAATATGAGATAGTGTGTTTAGCTGTTTGTTTCCTTATCCATTTGAAAGAG
TAGGTTAGTTATGTTTTGTGAACTTGGTGATTTTATTAGAGTTAGTTAAGAGAAAAATACAGTTTTGCACCCAAGAGTGATGTAGCGGAT
GATGAAGTTTTAATAGAAGTCACGGAGACTAAGATTCAGGTTCAAGTAGAGGCAAGAAAATCCACATAATTGATTTTCTCCCTTCTCCGT
AACTTTAGTGGGTAGAGTCACCCGTGACCTGTACTACTTGATATGATGCGGCACCTAGAATAAATGTCAAGGTATGTGGAAGTTGGCCGG
ATATCACCATTATTTCACGAGAGAAAGAGAGACCAAGATCCTGCAAGTGTCAACTTAAAAG
Reverse sequence
GGCTGAGATGCTTTGCTGATTGAAGACCATAGCTTCTATATTCTTTCTCAGTGAGGAAACGAGGTTCACTGTCAACCTCTCTAGGCATGA
TAAGGCGGCCTGCATGCTGCTGCCTTTCCCTTTCATGACCATATGATGAAAAATTCTCACCTGATTTGTTCCTTCCGTATTGCAATCCAA
CATGCTCCCTGGAAAGTTCCTTGCTAGGTAAAGGTGATGCTGATGGGGGCAGACTAACTGGATATGACACAGAATGTTTAAAAGTTGGAT
GTAGCCATGGTGCTGGCGTAAACAGCTTTTTCAACTGCCCTACCTGCTCAAAGGCGAAAAACAAGGCCACAAAATTGAAATCAAATGCTA
GGTAAATAACAAACTATCTCCAAGTAGAACTTGTCAATGAGAATTGTGTTGTTACCTGCTTAAATGTCAACTCAGTCTTGAACTTGTGAG
TTCTTTCGTCATAATTCTCTTGAATTGCTCTCTTGAACAAATTCTCCGTCAATGGAAGGCAGTCCTTGAAAATCCTG
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53279)
Chromosome
9
Position
71.30 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_9
Potato meta-QTL consensus map

Map: Eggplant-COSII   
Map version
63 (location: 42445)
Chromosome
9
Position
64.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Eggplant-LXM 2002   
Map version
29 (location: 8563)
Chromosome
9
Position
69.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8561)
Chromosome
6
Position
37.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8562)
Chromosome
9
Position
63.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8564)
Chromosome
9
Position
38.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG35 was used as an overgo probe on plate 5 [well D1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCCCTTCTCCGTAACTTTAGTGGG
B sequence
GTCACGGGTGACTCTACCCACTAA
AB sequence
TCCCTTCTCCGTAACTTTAGTGGGTAGAGT
Marker sequence
AAATGTGCAGTTTAGTGAATCAATCAACTAAACAATGCACAGTTACTAAT
TGAAGAAATACGCAAGCACGTATACATTTAACTGAACTCTACTTGTCAGG
AGAATGTAAAAAGAGAAATAACAAAGGTATAATATGAGATAGTGTGTTTA
GCTGTTTGTTTCCTTATCCATTTGAAAGAGTAGGTTAGTTATGTTTTGTG
AACTTGGTGATTTTATTAGAGTTAGTTAAGAGAAAAATACAGTTTTGCAC
CCAAGAGTGATGTAGCGGATGATGAAGTTTTAATAGAAGTCACGGAGACT
AAGATTCAGGTTCAAGTAGAGGCAAGAAAATCCACATAATTGATTTTCTC
CCTTCTCCGTAACTTTAGTGGGTAGAGTCACCCGTGACCTGTACTACTTG
ATATGATGCGGCACCTAGAATAAATGTCAAGGTATGTGGAAGTTGGCCGG
ATATCACCATTATTTCACGAGAGAAAGAGAGACCAAGATCCTGCAAGTGT
CAACTTAAAAG
Genomic location of TG35  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D200 marker 200
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)