SGN Marker T1434

SGN-M2000
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.07.01
Tomato EST read: TPTAT35TH
Arabidopsis best BAC match: AC013289.9
Arabidopsis position: 1.1353000
Arabidopsis identities: 0.961
Best GenBank protein hit: AAF22911.1
Evalue: 4.8e-56
Identities: 0.757
Description: putative aminolevulinate dehydratase; 38705-36189 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39619)
Chromosome
8
Position
36.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1434 was used as an overgo probe on plate 13 [well H8]

Plausible BAC Matches:   P111O17,   P022H14,   P184L22,   P202G09,   P186M17,   P244J03,   P170C07,   P186L17,   P076L05,   P177B24,   P210B22,   P284D11,   P037O11,   P257A01,   P168N16,   P309P02,   P257A02,   P293J17

 Overgo Sequences

A sequence
GAGGGTGTTGACCATTAGAGCTAG
B sequence
ATCATGCCCTTCCTTGCTAGCTCT
AB sequence
GAGGGTGTTGACCATTAGAGCTAGCAAGGA
Marker sequence
GCTTATCTGAGCAATCATGGCTTCTGCGGCAATGTTGAACGCACCTTGTA
ATATTGGAGCTGTAAAGTTTGAGGTGAAACTGAAGCCGTCGCCAAATTTG
TTTTGTGCACGGCCTTCTATTAAGTTGAATCAAAGGAGGGTGTTGACCAT
TAGAGCTAGCAAGGAAGGGCATGATAATGGGTCTAGCTCAAGGCCCTTGA
GAAAGATGGGGTTGACTGATGAGGAGTGTGAGGCTGCTGTAGTTGCCGGA
AATGTACCTGAAGCTCCTCCGGTTCCACCAAAGCCGGCTGCACCTGCCGG
TACCCCTATTGTGTCTTCACTGCCAATTAATAGGAGACCACGCCGTAATC
GTAGGTCGTCAGCAGCAAGAGCTGCATTCCACGAAACAAATATAAGCCCT
GCAAATCTTGTATATCCACTATTTATTCATGAGGGTGAAGAGGACACACC
TATTGGAGCAATGCCTGGATGTTATAGGCTTGGATGGAGGCATGGTCTTG
TTGAAGAGGTCGCAAAGGCAAGGGATGTTGGAGTCAACAGCATTGTGCTC
TTCCCAAAAGTTCCAGATGCTTTAAAGACCTCTACAGGAGATGAAGCTTA
CAATGACAATGGATTAGTGCCCCGAACAATACGTTTGCTGAAAGACAAAT
ACCCTGATCTTGGTATCTACACTGATG
Genomic location of T1434  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2000 marker 2000
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)