SGN Marker solcap_snp_sl_21005

SGN-M20006

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 71297)
Chromosome
11
Position
27.38 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67639)
Chromosome
11
Position
29.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64029)
Chromosome
11
Position
33.15 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56337)
Chromosome
11
Position
3.87 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CCTGGTGCTGGCAATGCTTTTACCTTCTCTAAAATAGTGATCAAGTCTTC
  
3' flanking region
ATATTGTGTCCGTCTACTGGACCGATGTAATATAATCCTAGCTCCTCAAA
SNP nucleotide
AG
SNPdb format
CCTGGTGCTGGCAATGCTTTTACCTTCTCTAAAATAGTGATCAAGTCTTC[A/G]
ATATTGTGTCCGTCTACTGGACCGATGTAATATAATCCTAGCTCCTCAAA
  
Genomic location of solcap_snp_sl_21005  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20006 marker 20006
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)