SGN Marker T1435

SGN-M2001
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 8.07
Tomato EST read: TPTAT42TH
Arabidopsis best BAC match: AL163814.1
Arabidopsis position: 5.0172400
Arabidopsis identities: 0.823
Best GenBank protein hit: CAB87689.1
Evalue: 3.2e-85
Identities: 0.867
Description: clathrin binding protein-like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49438)
Chromosome
8
Position
51.44 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47372)
Chromosome
8
Position
30.79 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39620)
Chromosome
8
Position
24.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1435 was used as an overgo probe on plate 12 [well C9]

Plausible BAC Matches:   P129O05,   P152F23,   P178C10,   P239G21,   P198E21,   P174E16,   P288H01,   P129M03

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GATCGAGCAGAAGGTATTGGATGC
B sequence
GGGCTCATCATCAGTAGCATCCAA
AB sequence
GATCGAGCAGAAGGTATTGGATGCTACTGA
Marker sequence
CCTTTCAGTTTCAGATCTCTATATCTTTTTCCAGAATTTTGAATCAGGTT
TCGCTTATTGGGTAGATTCAGCCATGGATTTCATGAAGGTCTTCGATCAA
ACGGTTCGCGAAATAAAGAGGGAGGTGAATTTGAAAGTATTGAAAGTCCC
TGAGATCGAGCAGAAGGTATTGGATGCTACTGATGATGAGCCCTGGGGCC
CTCACGGTACTGCTTTGGCTGAGATAGCACAGGCTACAAAAAAATTCTCC
GAGTGTCAGATGGTCATGAATGTGCTCTGGACAAGATTGACTGACACTGG
AAAGAACTGGCGTTATGTCTATAAGTCATTGGCTGTTATAGAGTACTTGG
TGGCGCATGGAGCTGAACGTGCAATTGATGACATCATAGAACATACCTAT
CAGATCTCTTCTCTCACAACTTTCGAGTATGTTGAGCCAAATGGTAAGGA
TGTGGGAATTAATGTGAGGAAGAAGGCGGAAAATGTTGTGGCATTATTGA
ATAACAGAGAGAAGATACAAGAGGTTAGGAGTAAAGCTACTGCAAATCGT
GAGAAGTACGTTGGACTATCATCTTCCGGAATAACATATAAGGCAAGCTC
TGCCTCTTTTAGTAGCAGCAGAA
Genomic location of T1435  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2001 marker 2001
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)