SGN Marker solcap_snp_sl_21029

SGN-M20024

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67647)
Chromosome
11
Position
31.09 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56355)
Chromosome
11
Position
4.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGAAGTGTTGCAAGGTTTTGCATGCCAATCAAATCTAGTTCTGTAAGAC
  
3' flanking region
AGACTGGTGCTGAATAATAGCTGATGGTAGTTTCCTTATCCCAGAACGTT
SNP nucleotide
AT
SNPdb format
TGGAAGTGTTGCAAGGTTTTGCATGCCAATCAAATCTAGTTCTGTAAGAC[A/T]
AGACTGGTGCTGAATAATAGCTGATGGTAGTTTCCTTATCCCAGAACGTT
  
Genomic location of solcap_snp_sl_21029  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20024 marker 20024
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)