SGN Marker T1438

SGN-M2003
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TPTAT53TH
Arabidopsis best BAC match: AL022603.1
Arabidopsis position: 4.1110000
Arabidopsis identities: 0.731
Best GenBank protein hit: CAB81259.1
Evalue: 1.5e-57
Identities: 0.529
Description: putative protein [Arabidopsis thaliana]
Comment: 4.00 e-47gb|AAA85261.1| (U13152) guanine nucleotide-binding protein beta 5 [Mesocricetus
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39621)
Chromosome
2
Position
70.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1438 was used as an overgo probe on plate 11 [well D6]

Plausible BAC Matches:   P329G05,   P116F12,   P047B24,   P264N14

 Overgo Sequences

A sequence
AGGGTGTCAAATGGTCTCCTGATG
B sequence
GTGAGGAAACCAGAACCATCAGGA
AB sequence
AGGGTGTCAAATGGTCTCCTGATGGTTCTG
Marker sequence
GCGGTTATTCACTATGATGTTCCGCCGTATCTAACCTATCATTTCTTCAA
TCAGTTCAGGACGCCTTCAAACCCTAATAATTTCTTAAAGGGTGTCAAAT
GGTCTCCTGATGGTTCTGGTTTCCTCACTTGCTCTGATGATAATACCTTT
TGTTTATATAACTTGCCATATGATGAAAGTGGACAGCTTGCTGATTTTTC
CTCATCAGCTGCTGATACAGATTCGTATGCTGCAAGTCTTGTCATGAGTG
ACGGGGAGTCTGTATATGACTATTGCTGGTATCCCTATATGTCTTCTTCA
AGTCCAGAGACGTGTGTTTTTGCAAGTACTACCCGTGATCACCCTATTCA
TCTCTGGGATGCTACTACTGGACAGTTACGCTGTACATACCGTGCTTATG
ATGCCATGGACGAGATCACTGCTGCCTTTTCGATTGCCTTCAATCCCGCA
GGGACTAAGATATTTGCTGGTTACAACAAATCCATAAGAATATTTGATAT
TCATCGGCCTGGCAGAGATTTTACCCAGCACTCCACCCTTCAAGGAAATA
AAGAAGGGCAATCAGGCATTATATCCTCAATGGCTTTCTGTCCAAGCCAT
TCAAGGTTACTGGCAACTGGCTCCTATAGCCAAACTACTGCCATACATAG
GGAAGATAACATGGAACTTCTCTATG
Genomic location of T1438  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2003 marker 2003
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)