Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker solcap_snp_sl_21038

SGN-M20032

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64038)
Chromosome
11
Position
35.17 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56363)
Chromosome
11
Position
4.18 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTTTGAGAAAACTATAAGAGCAACTTGAGACTCTTCGATACCTTTCAAGA
  
3' flanking region
TTCTTGGATCGAATCACCAAGCTCTAGCCTTTCATCACCTTGAAAGGTGA
SNP nucleotide
TG
SNPdb format
CTTTGAGAAAACTATAAGAGCAACTTGAGACTCTTCGATACCTTTCAAGA[T/G]
TTCTTGGATCGAATCACCAAGCTCTAGCCTTTCATCACCTTGAAAGGTGA
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of solcap_snp_sl_21038  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20032 marker 20032
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)