SGN Marker T1440

SGN-M2004
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAT63TH
Arabidopsis best BAC match: AC005990.1
Arabidopsis position: 1.0530000
Arabidopsis identities: 0.770
Best GenBank protein hit: AAC98029.1
Evalue: 6.0e-46
Identities: 0.821
Description: Strong similarity to gb|U20808 auxin-induced protein from Vigna radiata [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49439)
Chromosome
5
Position
0.35 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47373)
Chromosome
5
Position
2.98 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39622)
Chromosome
5
Position
5.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1440 was used as an overgo probe on plate 11 [well B7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GACGGCTCGGAAAATTTAAGGCCA
B sequence
GGAAGTGGAGAATCAGTGGCCTTA
AB sequence
GACGGCTCGGAAAATTTAAGGCCACTGATT
Marker sequence
GATTTCATCTTCTTTATCATGCACATAAATGGTTTGAGGAAAATACTGAG
TGAGAGGTTAAAAAAACAGCTGGAAAGAAAGAAGAACAATGAAAGCTCTA
TTATCTTCCACTACTCTTCAACTCAAACCCCTTCATCCACCCTCTTCTTT
CTCTTCTCTTCACTCTCCATTTTCTTCTATTTCTGTTCTTAGAGTAAAGG
GTAGCAAAAAAGCTGAAACTTTTATTCAAAGAAGCAAATTTTCCACTGTT
TTGCCACTTAAAGTCTCTTAACCCTGTTGATTTTAAACGACGGCTCGGAA
AATTTAAGGCCACTGATTCTCCACTTCCAACTGTGCCAGGTTATGATGTT
GCTGGTGTGGTAGTGAAAGTTGGTAGTCAGGTAAAGGGATTAAAAGAAGG
GGATGAAGTATATGGAGATATACATGAGAAAGCATTAGATGGACCAAAGC
AATTTGGATCCTTAGCTGAGTACACTGCTGTTGAAGAGAAACTAATTGCC
TTGAAACCCAAGAATCTTAGTTTTGCAGAAGCTGCTGCTCTTCCTCTAGC
TATTGAGACTGCTTATGAAGGTCTTGAGAAAGCAGGATTTTCTTCTGGCA
AATCCGGTCTTGTTTTGAGAGGTGCTGGCGGTGTTGGATCCCTAATAATC
CAGCTTGCTAAACATGTATTTGGTGCTTCTAAA
Genomic location of T1440  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2004 marker 2004
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)