SGN Marker solcap_snp_sl_21121

SGN-M20075

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67664)
Chromosome
11
Position
34.54 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56406)
Chromosome
11
Position
4.59 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CAAAAATATTTGCCAAGGTCTCAAATTTTTTGATAGCATCACCTAAAGCA
  
3' flanking region
AAGTAGTCTACATAGATTTTTAAGCAGATCAATTATTGGCTTACAAGTTG
SNP nucleotide
TG
SNPdb format
CAAAAATATTTGCCAAGGTCTCAAATTTTTTGATAGCATCACCTAAAGCA[T/G]
AAGTAGTCTACATAGATTTTTAAGCAGATCAATTATTGGCTTACAAGTTG
  
Genomic location of solcap_snp_sl_21121  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20075 marker 20075
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)