SGN Marker T1449

SGN-M2010
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAT92TH
Arabidopsis best BAC match: AB020745.1
Arabidopsis position: 5.1760000
Arabidopsis identities: 0.695
Best GenBank protein hit: BAA96959.1
Evalue: 6.7e-46
Identities: 0.549
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39625)
Chromosome
6
Position
93.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39626)
Chromosome
6
Position
5.00 cM
Confidence
CF(LOD3)
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1449 was used as an overgo probe on plate 3 [well F2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGAGAAGCATAGGAACCCTTGTTC
B sequence
GACAGTTGGTTCCACAGAACAAGG
AB sequence
GGAGAAGCATAGGAACCCTTGTTCTGTGGA
Marker sequence
GCAAACCCAAAATGGTCTAAAATCTCCGGCGTAATTTGCCGCCGACACCT
CTTCTTCGCCTATCGCCGCCTACGCCGATCGTGGAGTTTTGCCATGGAAG
ATACACAATCAGTTGCAACATTGATGGACTCTACAACATCTAAGATACAG
CAACTACAGAAAGCATTCGCTGAGTTGGAAAGTCACCGTGCTGTTACTCT
CAACCTGCAGTGGAAGCAACTTGAAGAGCACTTTAATGGGCTTCAGAAAT
CCTTGAAGAGGCGTTTCACTGAACTAGAAGACCAAGAGAAAGAGTTCGAG
ACAAAAATTGTTCAATCTACAGAGATATTGGAGAAGCGTCAAGCAGCTGT
TATTGCTAAAGAGCAAGCTTCTCTTCAGAGGCTCCAGGAGAAAAGAGATG
CAGCAGTTTCTGCCATTTCAATTGCTTTGGAGAAGCATAGGAACCCTTGT
TCTGTGGAACCAACTGTCATTAATTGTGTAGTTGAAGACGAGCCATCTGT
TCTGGAAGAGAAACCCGATAATTTAACAGAAATTGGGCTTGTTACAGGGG
ATACATGGAAATCTTTTCAGGATAGTGTTGTGGAAGTTAAGTCTTATCCA
GAGCTAGTTAATCTATGCCGAAATATGG
Genomic location of T1449  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2010 marker 2010
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)