SGN Marker T1451

SGN-M2012
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TPTAU12TH
Arabidopsis best BAC match: AC011765.4
Arabidopsis position: 1.1407000
Arabidopsis identities: 0.604
Best GenBank protein hit: AAF15929.1
Evalue: 8.7e-31
Identities: 0.604
Description: hypothetical protein; 77097-79388 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39627)
Chromosome
12
Position
57.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1451 was used as an overgo probe on plate 5 [well H9]

Plausible BAC Matches:   P021L01,   P048E18,   P259B01,   P232I03,   P284B24,   P297M12,   P148M11,   P105I04,   P153L10,   P125N02,   P042M23,   P225M11,   P334N05,   P164L03,   P199A02,   P131P23,   P029P05,   P258P20,   P067A23,   P066H08,   P035A01

 Overgo Sequences

A sequence
TCTAGCAACGGGCACTTGGTTGAG
B sequence
GCGAAAATGTTAGCGGCTCAACCA
AB sequence
TCTAGCAACGGGCACTTGGTTGAGCCGCTA
Marker sequence
CCCCATTTTTAATAACTCTAGCAACGGGCACTTGGTTGAGCCGCTAACAT
TTTCGCCGGCCGTCTCAATCTCTCTTGTCGCCGAACTAAACCCAGTAAAC
GACTCAGGTAATGCTATTCTACCATTTACATTTTTCTTATTTGTACTTTC
CCTGCCTGTAGTGAAAGAGTTGAATTGGTTTACTGGGTTTCATTGGGAGT
AATGATTGAGTTACTCAGAGACCTGAATTGAGCAACATCGATATAATTGA
CTTGTACTGTTTTGTTATCAAGCAAATGACTGCTGTTTTACTTCCTAAAC
ATGTTGCTGCTGTATTAAAATGTCAAAAGAACCCGTTAAGGGCACTAGAA
ATATTCAATTCAGTGAAAAAGGAACATGGGTTTAGCCATAATTTGTTTAC
ATACAAATGTATTGTTGAAAAGCTTAGTTATTATGGAGAGTTCAATGCAA
TGGAAAGTGTCATTGAAGAAGCCAGGAAAAATATTGATAATAGGTTGTTA
GAAGGGGTGTATATTACTGCTATTAGAGGTTATGGAAAGAAAGGGAAAGT
TCAACAGGCCGGTGATGTGTTTGAGAA
Genomic location of T1451  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2012 marker 2012
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)