SGN Marker solcap_snp_sl_21401

SGN-M20125

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67686)
Chromosome
8
Position
36.39 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64077)
Chromosome
8
Position
57.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 56456)
Chromosome
8
Position
56.20 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTGCTACAATTTGCGTAGTAATATCCTGGATAAAATTTTAAGAAGCTTGC
  
3' flanking region
TTTGAAAGATGCAGCGAAGAGCAATATCTTATCAAAAGACTGGAGGAACA
SNP nucleotide
CG
SNPdb format
GTGCTACAATTTGCGTAGTAATATCCTGGATAAAATTTTAAGAAGCTTGC[C/G]
TTTGAAAGATGCAGCGAAGAGCAATATCTTATCAAAAGACTGGAGGAACA
  
Genomic location of solcap_snp_sl_21401  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D20125 marker 20125
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)